Review



apmap silencer select sirna  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Thermo Fisher apmap silencer select sirna
    Apmap Silencer Select Sirna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/apmap+silencer+select+sirna/apmap+silencer+select+sirna/pm40318637-325-199-203
    Average 90 stars, based on 1 article reviews
    apmap silencer select sirna - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    cDNA Synthesis:

    Article Title: Paraoxonase-like APMAP maintains endoplasmic-reticulum-associated lipid and lipoprotein homeostasis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-HSP90B1 Sigma-Aldrich Cat# AMAB91019; RRID: AB_2665765 Rabbit anti-HSP90B1 Sigma-Aldrich Cat# HPA008424; RRID: AB_1851184 Rabbit anti-APMAP Sigma-Aldrich Cat# HPA012863; RRID: AB_1845683 Mouse anti-APMAP Novus Biologicals Cat# NBP2-01716 Rabbit anti-EGFP Abcam Cat# ab290; RRID:AB_2313768 Rabbit anti-mCherry Dr. Jonathan Friedman (UT Southwestern Medical Center); Abcam Cat# PA5-34974; RRID: AB_2552323 Mouse anti-CLIMP63 Enzo lifesciences Cat# G1/296; RRID: AB_2051140 Rabbit anti-calnexin Abcam Cat# ab22595; RRID: AB_2069006 Goat anti-Apolipoprotein B Rockland immunochemicals Cat# 600-101-111; RRID: AB_2056958 Rabbit anti-Apolipoprotein B Abcam Cat# ab20737; RRID: AB_2056954 Rabbit anti-ApoII Akhila Rajan (Hutch) N/A Mouse anti-ceramide Enzo lifesciences Cat# ALX-804-196; RRID: AB_10541503 Mouse anti-IRE1alpha Cell Signalling Cat# 14C10 Mouse anti-ERO1A, Clone 2G4/12 Sigma-Aldrich Cat# MABT376; RRID: AB_2941031 Mouse anti-P4HB Abcam Cat# ab2792; RRID: AB_303304 Mouse anti-beta actin Abcam Cat# ab8224; RRID: AB_449644 Rabbit GAPDH Abcam Cat# ab9485; RRID: AB_307275 Alexa Fluor 488 Donkey anti-mouse IgG Thermo Fisher Cat# A21202; RRID: AB_141607 Alexa Fluor 594 Donkey anti-mouse IgG Thermo Fisher Cat# A21203; RRID: AB_141633 Alexa Fluor 488 Donkey anti-rabbit IgG Thermo Fisher Cat# A21206; RRID: AB_2535792 Alexa Fluor 594 Donkey anti-rabbit IgG Thermo Fisher Cat# A21207; RRID: AB_141637 Alexa Fluor 488 Donkey anti-goat IgG Thermo fisher Cat# A11055; RRID: AB_2534102 Alexa Fluor 594 Donkey anti-goat IgG Thermo fisher Cat# A11058; RRID: AB_2534105 HRP-conjugated anti-goat IgG Thermo Fisher Cat# PA128664; RRID: AB_10990162 Chemicals, Peptides and Recombinant Proteins Oleic acid Sigma Cat# O1008 Tetramethylbenzidine (TMB) Peroxidase Millipore Sigma Cat# T0440 N-Acetyl Cysteine Sigma Cat# A9165 Tert-Butyl Hydroperoxide Thermo Fisher Cat# 180345000 Proteinase-K Sigma Cat# P2308 Digitonin Sigma Cat# 300410 Fumonisin B1 Sigma Cat# F1147 Myriocin Sigma Cat# M1177 Hydrogen peroxide Sigma Cat# H1009 BODIPY 581/591-C11 Thermo Fisher Cat# D3861 Triton X-100 N/A Autodot Abgent Cat# SM1000a Trizol Ambion Life Technologies Cat# 15596026 VLDL human purified protein Millipore Cat# LP1 Lipofectamine RNAiMAX reagent Thermo Scientific Cat# 13778075 Lipofectamine 3000 Invitrogen Cat# L3000015 Halt protease inhibitor cocktail Thermo Cat# 78429 (Continued on next page) ll Article Developmental Cell 60, 1–18.e1–e10, September 22, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays ReadyScript cDNA synthesis mix Sigma Cat# RDRT-100RXN Gibson assembly mix NEB Cat# E2611L Sso advanced universal SYBR green supermix Biorad Cat# 172-5274 Pierce BCA protein assay kit Thermo Scientific Cat# 23225 Deposited data APMAP TurboID proteomics dataset This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Zebrafish datasets This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Uncropped Western blots This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Experimental models: Cell lines, organisms and strains Human U2OS osteosarcoma cells ATCC U2OS U2OS cell with CRISPR-Cas9 APMAP-mNeonGreen Dr. Mike Henne lab (UT Southwestern Medical Center) APMAP-mNG Huh-7 Dr. Denise Marciano lab (UT Southwestern Medical Center) Huh7 Drosophila L3 late feeding larvae and 7-10 day old adults This study Drosophila larvae Dcg-GAL4 FB driver Dr. Jonathan Graff (UT Southwestern Medical Center) Dcg-Gal4 Da-GAL4 global driver Bloomington Stock Center N/A TRiP UAS-RNAi Hmu (dAPMAP) Bloomington Stock Center 41627 TRiP UAS-RNAi Hmu (dAPMAP) Bloomington Stock Center 41915 Cg-Gal4; UAS-Dcr2 FB driver Dr. Steve Jean (Université de Sherbrooke) N/A UAS-Sec61B-TdTomato Bloomington Stock Center 64747 Oligonucleotides Silencer negative control siRNA Thermo Fisher Cat# AM4611 Silencer Select negative control siRNA Thermo Fisher Cat# 4390843 APMAP silencer select siRNA Thermo Fisher Cat# 4392420; siRNA ID: s32757 APMAP forward primer (RT-PCR) This study CATTGCCCGGTTTGGTTCG APMAP reverse primer (RT-PCR) This study CACTTCACGTTTCCAGGGATTTA CHOP forward primer (RT-PCR) van Schadewijk et al.60 GCACCTCCCAGAGCCCTCACTCTCC CHOP reverse primer (RT-PCR) van Schadewijk et al.60 GTCTACTCCAAGCCTTCCCCCTGCG Xbp1 forward primer (RT-PCR) van Schadewijk et al.60 TGCTGAGTCCGCAGCAGGTG Xbp1 reverse primer (RT-PCR) van Schadewijk et al.60 GCTGGCAGGCTCTGGGGAAG SCD1 primer pairs (RT-PCR) KiCqStart Primers (Sigma Aldrich) H_SCD_1 (NM_005063) PRDX4 primer pairs (RT-PCR) KiCqStart Primers (Sigma Aldrich) H_PRDX4_1 (NM_006406) Cyclophillin Amplicon TATCTGCACTGCCAAGACTGAGTG Cyclophillin Amplicon CTTCTTGCTGGTCTTGCCATTCC Recombinant DNA APMAPFL-EGFP This study N/A Untagged APMAPFL This study N/A APMAPTM(1-77)-EGFP This study N/A APMAPAD(77-416)-EGFP This study N/A APMAPAD-KDEL This study N/A (Continued on next page) ll Article e2 Developmental Cell 60, 1–18.e1–e10, September 22, 2025 .. Experimental models include human Huh7 hepatocarcinoma cells (ATCC), AML12 murine hepatocytes (provided by Dr. Joan FontBurgada lab, FCCC), human U2OS (osteosarcoma cells) (ATCC), and zebrafish larvae (provided by Dr. Steven Farber lab, Johns Hopkins).

    SYBR Green Assay:

    Article Title: Paraoxonase-like APMAP maintains endoplasmic-reticulum-associated lipid and lipoprotein homeostasis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-HSP90B1 Sigma-Aldrich Cat# AMAB91019; RRID: AB_2665765 Rabbit anti-HSP90B1 Sigma-Aldrich Cat# HPA008424; RRID: AB_1851184 Rabbit anti-APMAP Sigma-Aldrich Cat# HPA012863; RRID: AB_1845683 Mouse anti-APMAP Novus Biologicals Cat# NBP2-01716 Rabbit anti-EGFP Abcam Cat# ab290; RRID:AB_2313768 Rabbit anti-mCherry Dr. Jonathan Friedman (UT Southwestern Medical Center); Abcam Cat# PA5-34974; RRID: AB_2552323 Mouse anti-CLIMP63 Enzo lifesciences Cat# G1/296; RRID: AB_2051140 Rabbit anti-calnexin Abcam Cat# ab22595; RRID: AB_2069006 Goat anti-Apolipoprotein B Rockland immunochemicals Cat# 600-101-111; RRID: AB_2056958 Rabbit anti-Apolipoprotein B Abcam Cat# ab20737; RRID: AB_2056954 Rabbit anti-ApoII Akhila Rajan (Hutch) N/A Mouse anti-ceramide Enzo lifesciences Cat# ALX-804-196; RRID: AB_10541503 Mouse anti-IRE1alpha Cell Signalling Cat# 14C10 Mouse anti-ERO1A, Clone 2G4/12 Sigma-Aldrich Cat# MABT376; RRID: AB_2941031 Mouse anti-P4HB Abcam Cat# ab2792; RRID: AB_303304 Mouse anti-beta actin Abcam Cat# ab8224; RRID: AB_449644 Rabbit GAPDH Abcam Cat# ab9485; RRID: AB_307275 Alexa Fluor 488 Donkey anti-mouse IgG Thermo Fisher Cat# A21202; RRID: AB_141607 Alexa Fluor 594 Donkey anti-mouse IgG Thermo Fisher Cat# A21203; RRID: AB_141633 Alexa Fluor 488 Donkey anti-rabbit IgG Thermo Fisher Cat# A21206; RRID: AB_2535792 Alexa Fluor 594 Donkey anti-rabbit IgG Thermo Fisher Cat# A21207; RRID: AB_141637 Alexa Fluor 488 Donkey anti-goat IgG Thermo fisher Cat# A11055; RRID: AB_2534102 Alexa Fluor 594 Donkey anti-goat IgG Thermo fisher Cat# A11058; RRID: AB_2534105 HRP-conjugated anti-goat IgG Thermo Fisher Cat# PA128664; RRID: AB_10990162 Chemicals, Peptides and Recombinant Proteins Oleic acid Sigma Cat# O1008 Tetramethylbenzidine (TMB) Peroxidase Millipore Sigma Cat# T0440 N-Acetyl Cysteine Sigma Cat# A9165 Tert-Butyl Hydroperoxide Thermo Fisher Cat# 180345000 Proteinase-K Sigma Cat# P2308 Digitonin Sigma Cat# 300410 Fumonisin B1 Sigma Cat# F1147 Myriocin Sigma Cat# M1177 Hydrogen peroxide Sigma Cat# H1009 BODIPY 581/591-C11 Thermo Fisher Cat# D3861 Triton X-100 N/A Autodot Abgent Cat# SM1000a Trizol Ambion Life Technologies Cat# 15596026 VLDL human purified protein Millipore Cat# LP1 Lipofectamine RNAiMAX reagent Thermo Scientific Cat# 13778075 Lipofectamine 3000 Invitrogen Cat# L3000015 Halt protease inhibitor cocktail Thermo Cat# 78429 (Continued on next page) ll Article Developmental Cell 60, 1–18.e1–e10, September 22, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays ReadyScript cDNA synthesis mix Sigma Cat# RDRT-100RXN Gibson assembly mix NEB Cat# E2611L Sso advanced universal SYBR green supermix Biorad Cat# 172-5274 Pierce BCA protein assay kit Thermo Scientific Cat# 23225 Deposited data APMAP TurboID proteomics dataset This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Zebrafish datasets This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Uncropped Western blots This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Experimental models: Cell lines, organisms and strains Human U2OS osteosarcoma cells ATCC U2OS U2OS cell with CRISPR-Cas9 APMAP-mNeonGreen Dr. Mike Henne lab (UT Southwestern Medical Center) APMAP-mNG Huh-7 Dr. Denise Marciano lab (UT Southwestern Medical Center) Huh7 Drosophila L3 late feeding larvae and 7-10 day old adults This study Drosophila larvae Dcg-GAL4 FB driver Dr. Jonathan Graff (UT Southwestern Medical Center) Dcg-Gal4 Da-GAL4 global driver Bloomington Stock Center N/A TRiP UAS-RNAi Hmu (dAPMAP) Bloomington Stock Center 41627 TRiP UAS-RNAi Hmu (dAPMAP) Bloomington Stock Center 41915 Cg-Gal4; UAS-Dcr2 FB driver Dr. Steve Jean (Université de Sherbrooke) N/A UAS-Sec61B-TdTomato Bloomington Stock Center 64747 Oligonucleotides Silencer negative control siRNA Thermo Fisher Cat# AM4611 Silencer Select negative control siRNA Thermo Fisher Cat# 4390843 APMAP silencer select siRNA Thermo Fisher Cat# 4392420; siRNA ID: s32757 APMAP forward primer (RT-PCR) This study CATTGCCCGGTTTGGTTCG APMAP reverse primer (RT-PCR) This study CACTTCACGTTTCCAGGGATTTA CHOP forward primer (RT-PCR) van Schadewijk et al.60 GCACCTCCCAGAGCCCTCACTCTCC CHOP reverse primer (RT-PCR) van Schadewijk et al.60 GTCTACTCCAAGCCTTCCCCCTGCG Xbp1 forward primer (RT-PCR) van Schadewijk et al.60 TGCTGAGTCCGCAGCAGGTG Xbp1 reverse primer (RT-PCR) van Schadewijk et al.60 GCTGGCAGGCTCTGGGGAAG SCD1 primer pairs (RT-PCR) KiCqStart Primers (Sigma Aldrich) H_SCD_1 (NM_005063) PRDX4 primer pairs (RT-PCR) KiCqStart Primers (Sigma Aldrich) H_PRDX4_1 (NM_006406) Cyclophillin Amplicon TATCTGCACTGCCAAGACTGAGTG Cyclophillin Amplicon CTTCTTGCTGGTCTTGCCATTCC Recombinant DNA APMAPFL-EGFP This study N/A Untagged APMAPFL This study N/A APMAPTM(1-77)-EGFP This study N/A APMAPAD(77-416)-EGFP This study N/A APMAPAD-KDEL This study N/A (Continued on next page) ll Article e2 Developmental Cell 60, 1–18.e1–e10, September 22, 2025 .. Experimental models include human Huh7 hepatocarcinoma cells (ATCC), AML12 murine hepatocytes (provided by Dr. Joan FontBurgada lab, FCCC), human U2OS (osteosarcoma cells) (ATCC), and zebrafish larvae (provided by Dr. Steven Farber lab, Johns Hopkins).

    Bicinchoninic Acid Protein Assay:

    Article Title: Paraoxonase-like APMAP maintains endoplasmic-reticulum-associated lipid and lipoprotein homeostasis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-HSP90B1 Sigma-Aldrich Cat# AMAB91019; RRID: AB_2665765 Rabbit anti-HSP90B1 Sigma-Aldrich Cat# HPA008424; RRID: AB_1851184 Rabbit anti-APMAP Sigma-Aldrich Cat# HPA012863; RRID: AB_1845683 Mouse anti-APMAP Novus Biologicals Cat# NBP2-01716 Rabbit anti-EGFP Abcam Cat# ab290; RRID:AB_2313768 Rabbit anti-mCherry Dr. Jonathan Friedman (UT Southwestern Medical Center); Abcam Cat# PA5-34974; RRID: AB_2552323 Mouse anti-CLIMP63 Enzo lifesciences Cat# G1/296; RRID: AB_2051140 Rabbit anti-calnexin Abcam Cat# ab22595; RRID: AB_2069006 Goat anti-Apolipoprotein B Rockland immunochemicals Cat# 600-101-111; RRID: AB_2056958 Rabbit anti-Apolipoprotein B Abcam Cat# ab20737; RRID: AB_2056954 Rabbit anti-ApoII Akhila Rajan (Hutch) N/A Mouse anti-ceramide Enzo lifesciences Cat# ALX-804-196; RRID: AB_10541503 Mouse anti-IRE1alpha Cell Signalling Cat# 14C10 Mouse anti-ERO1A, Clone 2G4/12 Sigma-Aldrich Cat# MABT376; RRID: AB_2941031 Mouse anti-P4HB Abcam Cat# ab2792; RRID: AB_303304 Mouse anti-beta actin Abcam Cat# ab8224; RRID: AB_449644 Rabbit GAPDH Abcam Cat# ab9485; RRID: AB_307275 Alexa Fluor 488 Donkey anti-mouse IgG Thermo Fisher Cat# A21202; RRID: AB_141607 Alexa Fluor 594 Donkey anti-mouse IgG Thermo Fisher Cat# A21203; RRID: AB_141633 Alexa Fluor 488 Donkey anti-rabbit IgG Thermo Fisher Cat# A21206; RRID: AB_2535792 Alexa Fluor 594 Donkey anti-rabbit IgG Thermo Fisher Cat# A21207; RRID: AB_141637 Alexa Fluor 488 Donkey anti-goat IgG Thermo fisher Cat# A11055; RRID: AB_2534102 Alexa Fluor 594 Donkey anti-goat IgG Thermo fisher Cat# A11058; RRID: AB_2534105 HRP-conjugated anti-goat IgG Thermo Fisher Cat# PA128664; RRID: AB_10990162 Chemicals, Peptides and Recombinant Proteins Oleic acid Sigma Cat# O1008 Tetramethylbenzidine (TMB) Peroxidase Millipore Sigma Cat# T0440 N-Acetyl Cysteine Sigma Cat# A9165 Tert-Butyl Hydroperoxide Thermo Fisher Cat# 180345000 Proteinase-K Sigma Cat# P2308 Digitonin Sigma Cat# 300410 Fumonisin B1 Sigma Cat# F1147 Myriocin Sigma Cat# M1177 Hydrogen peroxide Sigma Cat# H1009 BODIPY 581/591-C11 Thermo Fisher Cat# D3861 Triton X-100 N/A Autodot Abgent Cat# SM1000a Trizol Ambion Life Technologies Cat# 15596026 VLDL human purified protein Millipore Cat# LP1 Lipofectamine RNAiMAX reagent Thermo Scientific Cat# 13778075 Lipofectamine 3000 Invitrogen Cat# L3000015 Halt protease inhibitor cocktail Thermo Cat# 78429 (Continued on next page) ll Article Developmental Cell 60, 1–18.e1–e10, September 22, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays ReadyScript cDNA synthesis mix Sigma Cat# RDRT-100RXN Gibson assembly mix NEB Cat# E2611L Sso advanced universal SYBR green supermix Biorad Cat# 172-5274 Pierce BCA protein assay kit Thermo Scientific Cat# 23225 Deposited data APMAP TurboID proteomics dataset This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Zebrafish datasets This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Uncropped Western blots This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Experimental models: Cell lines, organisms and strains Human U2OS osteosarcoma cells ATCC U2OS U2OS cell with CRISPR-Cas9 APMAP-mNeonGreen Dr. Mike Henne lab (UT Southwestern Medical Center) APMAP-mNG Huh-7 Dr. Denise Marciano lab (UT Southwestern Medical Center) Huh7 Drosophila L3 late feeding larvae and 7-10 day old adults This study Drosophila larvae Dcg-GAL4 FB driver Dr. Jonathan Graff (UT Southwestern Medical Center) Dcg-Gal4 Da-GAL4 global driver Bloomington Stock Center N/A TRiP UAS-RNAi Hmu (dAPMAP) Bloomington Stock Center 41627 TRiP UAS-RNAi Hmu (dAPMAP) Bloomington Stock Center 41915 Cg-Gal4; UAS-Dcr2 FB driver Dr. Steve Jean (Université de Sherbrooke) N/A UAS-Sec61B-TdTomato Bloomington Stock Center 64747 Oligonucleotides Silencer negative control siRNA Thermo Fisher Cat# AM4611 Silencer Select negative control siRNA Thermo Fisher Cat# 4390843 APMAP silencer select siRNA Thermo Fisher Cat# 4392420; siRNA ID: s32757 APMAP forward primer (RT-PCR) This study CATTGCCCGGTTTGGTTCG APMAP reverse primer (RT-PCR) This study CACTTCACGTTTCCAGGGATTTA CHOP forward primer (RT-PCR) van Schadewijk et al.60 GCACCTCCCAGAGCCCTCACTCTCC CHOP reverse primer (RT-PCR) van Schadewijk et al.60 GTCTACTCCAAGCCTTCCCCCTGCG Xbp1 forward primer (RT-PCR) van Schadewijk et al.60 TGCTGAGTCCGCAGCAGGTG Xbp1 reverse primer (RT-PCR) van Schadewijk et al.60 GCTGGCAGGCTCTGGGGAAG SCD1 primer pairs (RT-PCR) KiCqStart Primers (Sigma Aldrich) H_SCD_1 (NM_005063) PRDX4 primer pairs (RT-PCR) KiCqStart Primers (Sigma Aldrich) H_PRDX4_1 (NM_006406) Cyclophillin Amplicon TATCTGCACTGCCAAGACTGAGTG Cyclophillin Amplicon CTTCTTGCTGGTCTTGCCATTCC Recombinant DNA APMAPFL-EGFP This study N/A Untagged APMAPFL This study N/A APMAPTM(1-77)-EGFP This study N/A APMAPAD(77-416)-EGFP This study N/A APMAPAD-KDEL This study N/A (Continued on next page) ll Article e2 Developmental Cell 60, 1–18.e1–e10, September 22, 2025 .. Experimental models include human Huh7 hepatocarcinoma cells (ATCC), AML12 murine hepatocytes (provided by Dr. Joan FontBurgada lab, FCCC), human U2OS (osteosarcoma cells) (ATCC), and zebrafish larvae (provided by Dr. Steven Farber lab, Johns Hopkins).

    Western Blot:

    Article Title: Paraoxonase-like APMAP maintains endoplasmic-reticulum-associated lipid and lipoprotein homeostasis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-HSP90B1 Sigma-Aldrich Cat# AMAB91019; RRID: AB_2665765 Rabbit anti-HSP90B1 Sigma-Aldrich Cat# HPA008424; RRID: AB_1851184 Rabbit anti-APMAP Sigma-Aldrich Cat# HPA012863; RRID: AB_1845683 Mouse anti-APMAP Novus Biologicals Cat# NBP2-01716 Rabbit anti-EGFP Abcam Cat# ab290; RRID:AB_2313768 Rabbit anti-mCherry Dr. Jonathan Friedman (UT Southwestern Medical Center); Abcam Cat# PA5-34974; RRID: AB_2552323 Mouse anti-CLIMP63 Enzo lifesciences Cat# G1/296; RRID: AB_2051140 Rabbit anti-calnexin Abcam Cat# ab22595; RRID: AB_2069006 Goat anti-Apolipoprotein B Rockland immunochemicals Cat# 600-101-111; RRID: AB_2056958 Rabbit anti-Apolipoprotein B Abcam Cat# ab20737; RRID: AB_2056954 Rabbit anti-ApoII Akhila Rajan (Hutch) N/A Mouse anti-ceramide Enzo lifesciences Cat# ALX-804-196; RRID: AB_10541503 Mouse anti-IRE1alpha Cell Signalling Cat# 14C10 Mouse anti-ERO1A, Clone 2G4/12 Sigma-Aldrich Cat# MABT376; RRID: AB_2941031 Mouse anti-P4HB Abcam Cat# ab2792; RRID: AB_303304 Mouse anti-beta actin Abcam Cat# ab8224; RRID: AB_449644 Rabbit GAPDH Abcam Cat# ab9485; RRID: AB_307275 Alexa Fluor 488 Donkey anti-mouse IgG Thermo Fisher Cat# A21202; RRID: AB_141607 Alexa Fluor 594 Donkey anti-mouse IgG Thermo Fisher Cat# A21203; RRID: AB_141633 Alexa Fluor 488 Donkey anti-rabbit IgG Thermo Fisher Cat# A21206; RRID: AB_2535792 Alexa Fluor 594 Donkey anti-rabbit IgG Thermo Fisher Cat# A21207; RRID: AB_141637 Alexa Fluor 488 Donkey anti-goat IgG Thermo fisher Cat# A11055; RRID: AB_2534102 Alexa Fluor 594 Donkey anti-goat IgG Thermo fisher Cat# A11058; RRID: AB_2534105 HRP-conjugated anti-goat IgG Thermo Fisher Cat# PA128664; RRID: AB_10990162 Chemicals, Peptides and Recombinant Proteins Oleic acid Sigma Cat# O1008 Tetramethylbenzidine (TMB) Peroxidase Millipore Sigma Cat# T0440 N-Acetyl Cysteine Sigma Cat# A9165 Tert-Butyl Hydroperoxide Thermo Fisher Cat# 180345000 Proteinase-K Sigma Cat# P2308 Digitonin Sigma Cat# 300410 Fumonisin B1 Sigma Cat# F1147 Myriocin Sigma Cat# M1177 Hydrogen peroxide Sigma Cat# H1009 BODIPY 581/591-C11 Thermo Fisher Cat# D3861 Triton X-100 N/A Autodot Abgent Cat# SM1000a Trizol Ambion Life Technologies Cat# 15596026 VLDL human purified protein Millipore Cat# LP1 Lipofectamine RNAiMAX reagent Thermo Scientific Cat# 13778075 Lipofectamine 3000 Invitrogen Cat# L3000015 Halt protease inhibitor cocktail Thermo Cat# 78429 (Continued on next page) ll Article Developmental Cell 60, 1–18.e1–e10, September 22, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays ReadyScript cDNA synthesis mix Sigma Cat# RDRT-100RXN Gibson assembly mix NEB Cat# E2611L Sso advanced universal SYBR green supermix Biorad Cat# 172-5274 Pierce BCA protein assay kit Thermo Scientific Cat# 23225 Deposited data APMAP TurboID proteomics dataset This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Zebrafish datasets This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Uncropped Western blots This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Experimental models: Cell lines, organisms and strains Human U2OS osteosarcoma cells ATCC U2OS U2OS cell with CRISPR-Cas9 APMAP-mNeonGreen Dr. Mike Henne lab (UT Southwestern Medical Center) APMAP-mNG Huh-7 Dr. Denise Marciano lab (UT Southwestern Medical Center) Huh7 Drosophila L3 late feeding larvae and 7-10 day old adults This study Drosophila larvae Dcg-GAL4 FB driver Dr. Jonathan Graff (UT Southwestern Medical Center) Dcg-Gal4 Da-GAL4 global driver Bloomington Stock Center N/A TRiP UAS-RNAi Hmu (dAPMAP) Bloomington Stock Center 41627 TRiP UAS-RNAi Hmu (dAPMAP) Bloomington Stock Center 41915 Cg-Gal4; UAS-Dcr2 FB driver Dr. Steve Jean (Université de Sherbrooke) N/A UAS-Sec61B-TdTomato Bloomington Stock Center 64747 Oligonucleotides Silencer negative control siRNA Thermo Fisher Cat# AM4611 Silencer Select negative control siRNA Thermo Fisher Cat# 4390843 APMAP silencer select siRNA Thermo Fisher Cat# 4392420; siRNA ID: s32757 APMAP forward primer (RT-PCR) This study CATTGCCCGGTTTGGTTCG APMAP reverse primer (RT-PCR) This study CACTTCACGTTTCCAGGGATTTA CHOP forward primer (RT-PCR) van Schadewijk et al.60 GCACCTCCCAGAGCCCTCACTCTCC CHOP reverse primer (RT-PCR) van Schadewijk et al.60 GTCTACTCCAAGCCTTCCCCCTGCG Xbp1 forward primer (RT-PCR) van Schadewijk et al.60 TGCTGAGTCCGCAGCAGGTG Xbp1 reverse primer (RT-PCR) van Schadewijk et al.60 GCTGGCAGGCTCTGGGGAAG SCD1 primer pairs (RT-PCR) KiCqStart Primers (Sigma Aldrich) H_SCD_1 (NM_005063) PRDX4 primer pairs (RT-PCR) KiCqStart Primers (Sigma Aldrich) H_PRDX4_1 (NM_006406) Cyclophillin Amplicon TATCTGCACTGCCAAGACTGAGTG Cyclophillin Amplicon CTTCTTGCTGGTCTTGCCATTCC Recombinant DNA APMAPFL-EGFP This study N/A Untagged APMAPFL This study N/A APMAPTM(1-77)-EGFP This study N/A APMAPAD(77-416)-EGFP This study N/A APMAPAD-KDEL This study N/A (Continued on next page) ll Article e2 Developmental Cell 60, 1–18.e1–e10, September 22, 2025 .. Experimental models include human Huh7 hepatocarcinoma cells (ATCC), AML12 murine hepatocytes (provided by Dr. Joan FontBurgada lab, FCCC), human U2OS (osteosarcoma cells) (ATCC), and zebrafish larvae (provided by Dr. Steven Farber lab, Johns Hopkins).

    CRISPR:

    Article Title: Paraoxonase-like APMAP maintains endoplasmic-reticulum-associated lipid and lipoprotein homeostasis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-HSP90B1 Sigma-Aldrich Cat# AMAB91019; RRID: AB_2665765 Rabbit anti-HSP90B1 Sigma-Aldrich Cat# HPA008424; RRID: AB_1851184 Rabbit anti-APMAP Sigma-Aldrich Cat# HPA012863; RRID: AB_1845683 Mouse anti-APMAP Novus Biologicals Cat# NBP2-01716 Rabbit anti-EGFP Abcam Cat# ab290; RRID:AB_2313768 Rabbit anti-mCherry Dr. Jonathan Friedman (UT Southwestern Medical Center); Abcam Cat# PA5-34974; RRID: AB_2552323 Mouse anti-CLIMP63 Enzo lifesciences Cat# G1/296; RRID: AB_2051140 Rabbit anti-calnexin Abcam Cat# ab22595; RRID: AB_2069006 Goat anti-Apolipoprotein B Rockland immunochemicals Cat# 600-101-111; RRID: AB_2056958 Rabbit anti-Apolipoprotein B Abcam Cat# ab20737; RRID: AB_2056954 Rabbit anti-ApoII Akhila Rajan (Hutch) N/A Mouse anti-ceramide Enzo lifesciences Cat# ALX-804-196; RRID: AB_10541503 Mouse anti-IRE1alpha Cell Signalling Cat# 14C10 Mouse anti-ERO1A, Clone 2G4/12 Sigma-Aldrich Cat# MABT376; RRID: AB_2941031 Mouse anti-P4HB Abcam Cat# ab2792; RRID: AB_303304 Mouse anti-beta actin Abcam Cat# ab8224; RRID: AB_449644 Rabbit GAPDH Abcam Cat# ab9485; RRID: AB_307275 Alexa Fluor 488 Donkey anti-mouse IgG Thermo Fisher Cat# A21202; RRID: AB_141607 Alexa Fluor 594 Donkey anti-mouse IgG Thermo Fisher Cat# A21203; RRID: AB_141633 Alexa Fluor 488 Donkey anti-rabbit IgG Thermo Fisher Cat# A21206; RRID: AB_2535792 Alexa Fluor 594 Donkey anti-rabbit IgG Thermo Fisher Cat# A21207; RRID: AB_141637 Alexa Fluor 488 Donkey anti-goat IgG Thermo fisher Cat# A11055; RRID: AB_2534102 Alexa Fluor 594 Donkey anti-goat IgG Thermo fisher Cat# A11058; RRID: AB_2534105 HRP-conjugated anti-goat IgG Thermo Fisher Cat# PA128664; RRID: AB_10990162 Chemicals, Peptides and Recombinant Proteins Oleic acid Sigma Cat# O1008 Tetramethylbenzidine (TMB) Peroxidase Millipore Sigma Cat# T0440 N-Acetyl Cysteine Sigma Cat# A9165 Tert-Butyl Hydroperoxide Thermo Fisher Cat# 180345000 Proteinase-K Sigma Cat# P2308 Digitonin Sigma Cat# 300410 Fumonisin B1 Sigma Cat# F1147 Myriocin Sigma Cat# M1177 Hydrogen peroxide Sigma Cat# H1009 BODIPY 581/591-C11 Thermo Fisher Cat# D3861 Triton X-100 N/A Autodot Abgent Cat# SM1000a Trizol Ambion Life Technologies Cat# 15596026 VLDL human purified protein Millipore Cat# LP1 Lipofectamine RNAiMAX reagent Thermo Scientific Cat# 13778075 Lipofectamine 3000 Invitrogen Cat# L3000015 Halt protease inhibitor cocktail Thermo Cat# 78429 (Continued on next page) ll Article Developmental Cell 60, 1–18.e1–e10, September 22, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays ReadyScript cDNA synthesis mix Sigma Cat# RDRT-100RXN Gibson assembly mix NEB Cat# E2611L Sso advanced universal SYBR green supermix Biorad Cat# 172-5274 Pierce BCA protein assay kit Thermo Scientific Cat# 23225 Deposited data APMAP TurboID proteomics dataset This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Zebrafish datasets This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Uncropped Western blots This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Experimental models: Cell lines, organisms and strains Human U2OS osteosarcoma cells ATCC U2OS U2OS cell with CRISPR-Cas9 APMAP-mNeonGreen Dr. Mike Henne lab (UT Southwestern Medical Center) APMAP-mNG Huh-7 Dr. Denise Marciano lab (UT Southwestern Medical Center) Huh7 Drosophila L3 late feeding larvae and 7-10 day old adults This study Drosophila larvae Dcg-GAL4 FB driver Dr. Jonathan Graff (UT Southwestern Medical Center) Dcg-Gal4 Da-GAL4 global driver Bloomington Stock Center N/A TRiP UAS-RNAi Hmu (dAPMAP) Bloomington Stock Center 41627 TRiP UAS-RNAi Hmu (dAPMAP) Bloomington Stock Center 41915 Cg-Gal4; UAS-Dcr2 FB driver Dr. Steve Jean (Université de Sherbrooke) N/A UAS-Sec61B-TdTomato Bloomington Stock Center 64747 Oligonucleotides Silencer negative control siRNA Thermo Fisher Cat# AM4611 Silencer Select negative control siRNA Thermo Fisher Cat# 4390843 APMAP silencer select siRNA Thermo Fisher Cat# 4392420; siRNA ID: s32757 APMAP forward primer (RT-PCR) This study CATTGCCCGGTTTGGTTCG APMAP reverse primer (RT-PCR) This study CACTTCACGTTTCCAGGGATTTA CHOP forward primer (RT-PCR) van Schadewijk et al.60 GCACCTCCCAGAGCCCTCACTCTCC CHOP reverse primer (RT-PCR) van Schadewijk et al.60 GTCTACTCCAAGCCTTCCCCCTGCG Xbp1 forward primer (RT-PCR) van Schadewijk et al.60 TGCTGAGTCCGCAGCAGGTG Xbp1 reverse primer (RT-PCR) van Schadewijk et al.60 GCTGGCAGGCTCTGGGGAAG SCD1 primer pairs (RT-PCR) KiCqStart Primers (Sigma Aldrich) H_SCD_1 (NM_005063) PRDX4 primer pairs (RT-PCR) KiCqStart Primers (Sigma Aldrich) H_PRDX4_1 (NM_006406) Cyclophillin Amplicon TATCTGCACTGCCAAGACTGAGTG Cyclophillin Amplicon CTTCTTGCTGGTCTTGCCATTCC Recombinant DNA APMAPFL-EGFP This study N/A Untagged APMAPFL This study N/A APMAPTM(1-77)-EGFP This study N/A APMAPAD(77-416)-EGFP This study N/A APMAPAD-KDEL This study N/A (Continued on next page) ll Article e2 Developmental Cell 60, 1–18.e1–e10, September 22, 2025 .. Experimental models include human Huh7 hepatocarcinoma cells (ATCC), AML12 murine hepatocytes (provided by Dr. Joan FontBurgada lab, FCCC), human U2OS (osteosarcoma cells) (ATCC), and zebrafish larvae (provided by Dr. Steven Farber lab, Johns Hopkins).

    Negative Control:

    Article Title: Paraoxonase-like APMAP maintains endoplasmic-reticulum-associated lipid and lipoprotein homeostasis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-HSP90B1 Sigma-Aldrich Cat# AMAB91019; RRID: AB_2665765 Rabbit anti-HSP90B1 Sigma-Aldrich Cat# HPA008424; RRID: AB_1851184 Rabbit anti-APMAP Sigma-Aldrich Cat# HPA012863; RRID: AB_1845683 Mouse anti-APMAP Novus Biologicals Cat# NBP2-01716 Rabbit anti-EGFP Abcam Cat# ab290; RRID:AB_2313768 Rabbit anti-mCherry Dr. Jonathan Friedman (UT Southwestern Medical Center); Abcam Cat# PA5-34974; RRID: AB_2552323 Mouse anti-CLIMP63 Enzo lifesciences Cat# G1/296; RRID: AB_2051140 Rabbit anti-calnexin Abcam Cat# ab22595; RRID: AB_2069006 Goat anti-Apolipoprotein B Rockland immunochemicals Cat# 600-101-111; RRID: AB_2056958 Rabbit anti-Apolipoprotein B Abcam Cat# ab20737; RRID: AB_2056954 Rabbit anti-ApoII Akhila Rajan (Hutch) N/A Mouse anti-ceramide Enzo lifesciences Cat# ALX-804-196; RRID: AB_10541503 Mouse anti-IRE1alpha Cell Signalling Cat# 14C10 Mouse anti-ERO1A, Clone 2G4/12 Sigma-Aldrich Cat# MABT376; RRID: AB_2941031 Mouse anti-P4HB Abcam Cat# ab2792; RRID: AB_303304 Mouse anti-beta actin Abcam Cat# ab8224; RRID: AB_449644 Rabbit GAPDH Abcam Cat# ab9485; RRID: AB_307275 Alexa Fluor 488 Donkey anti-mouse IgG Thermo Fisher Cat# A21202; RRID: AB_141607 Alexa Fluor 594 Donkey anti-mouse IgG Thermo Fisher Cat# A21203; RRID: AB_141633 Alexa Fluor 488 Donkey anti-rabbit IgG Thermo Fisher Cat# A21206; RRID: AB_2535792 Alexa Fluor 594 Donkey anti-rabbit IgG Thermo Fisher Cat# A21207; RRID: AB_141637 Alexa Fluor 488 Donkey anti-goat IgG Thermo fisher Cat# A11055; RRID: AB_2534102 Alexa Fluor 594 Donkey anti-goat IgG Thermo fisher Cat# A11058; RRID: AB_2534105 HRP-conjugated anti-goat IgG Thermo Fisher Cat# PA128664; RRID: AB_10990162 Chemicals, Peptides and Recombinant Proteins Oleic acid Sigma Cat# O1008 Tetramethylbenzidine (TMB) Peroxidase Millipore Sigma Cat# T0440 N-Acetyl Cysteine Sigma Cat# A9165 Tert-Butyl Hydroperoxide Thermo Fisher Cat# 180345000 Proteinase-K Sigma Cat# P2308 Digitonin Sigma Cat# 300410 Fumonisin B1 Sigma Cat# F1147 Myriocin Sigma Cat# M1177 Hydrogen peroxide Sigma Cat# H1009 BODIPY 581/591-C11 Thermo Fisher Cat# D3861 Triton X-100 N/A Autodot Abgent Cat# SM1000a Trizol Ambion Life Technologies Cat# 15596026 VLDL human purified protein Millipore Cat# LP1 Lipofectamine RNAiMAX reagent Thermo Scientific Cat# 13778075 Lipofectamine 3000 Invitrogen Cat# L3000015 Halt protease inhibitor cocktail Thermo Cat# 78429 (Continued on next page) ll Article Developmental Cell 60, 1–18.e1–e10, September 22, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays ReadyScript cDNA synthesis mix Sigma Cat# RDRT-100RXN Gibson assembly mix NEB Cat# E2611L Sso advanced universal SYBR green supermix Biorad Cat# 172-5274 Pierce BCA protein assay kit Thermo Scientific Cat# 23225 Deposited data APMAP TurboID proteomics dataset This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Zebrafish datasets This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Uncropped Western blots This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Experimental models: Cell lines, organisms and strains Human U2OS osteosarcoma cells ATCC U2OS U2OS cell with CRISPR-Cas9 APMAP-mNeonGreen Dr. Mike Henne lab (UT Southwestern Medical Center) APMAP-mNG Huh-7 Dr. Denise Marciano lab (UT Southwestern Medical Center) Huh7 Drosophila L3 late feeding larvae and 7-10 day old adults This study Drosophila larvae Dcg-GAL4 FB driver Dr. Jonathan Graff (UT Southwestern Medical Center) Dcg-Gal4 Da-GAL4 global driver Bloomington Stock Center N/A TRiP UAS-RNAi Hmu (dAPMAP) Bloomington Stock Center 41627 TRiP UAS-RNAi Hmu (dAPMAP) Bloomington Stock Center 41915 Cg-Gal4; UAS-Dcr2 FB driver Dr. Steve Jean (Université de Sherbrooke) N/A UAS-Sec61B-TdTomato Bloomington Stock Center 64747 Oligonucleotides Silencer negative control siRNA Thermo Fisher Cat# AM4611 Silencer Select negative control siRNA Thermo Fisher Cat# 4390843 APMAP silencer select siRNA Thermo Fisher Cat# 4392420; siRNA ID: s32757 APMAP forward primer (RT-PCR) This study CATTGCCCGGTTTGGTTCG APMAP reverse primer (RT-PCR) This study CACTTCACGTTTCCAGGGATTTA CHOP forward primer (RT-PCR) van Schadewijk et al.60 GCACCTCCCAGAGCCCTCACTCTCC CHOP reverse primer (RT-PCR) van Schadewijk et al.60 GTCTACTCCAAGCCTTCCCCCTGCG Xbp1 forward primer (RT-PCR) van Schadewijk et al.60 TGCTGAGTCCGCAGCAGGTG Xbp1 reverse primer (RT-PCR) van Schadewijk et al.60 GCTGGCAGGCTCTGGGGAAG SCD1 primer pairs (RT-PCR) KiCqStart Primers (Sigma Aldrich) H_SCD_1 (NM_005063) PRDX4 primer pairs (RT-PCR) KiCqStart Primers (Sigma Aldrich) H_PRDX4_1 (NM_006406) Cyclophillin Amplicon TATCTGCACTGCCAAGACTGAGTG Cyclophillin Amplicon CTTCTTGCTGGTCTTGCCATTCC Recombinant DNA APMAPFL-EGFP This study N/A Untagged APMAPFL This study N/A APMAPTM(1-77)-EGFP This study N/A APMAPAD(77-416)-EGFP This study N/A APMAPAD-KDEL This study N/A (Continued on next page) ll Article e2 Developmental Cell 60, 1–18.e1–e10, September 22, 2025 .. Experimental models include human Huh7 hepatocarcinoma cells (ATCC), AML12 murine hepatocytes (provided by Dr. Joan FontBurgada lab, FCCC), human U2OS (osteosarcoma cells) (ATCC), and zebrafish larvae (provided by Dr. Steven Farber lab, Johns Hopkins).

    Amplification:

    Article Title: Paraoxonase-like APMAP maintains endoplasmic-reticulum-associated lipid and lipoprotein homeostasis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-HSP90B1 Sigma-Aldrich Cat# AMAB91019; RRID: AB_2665765 Rabbit anti-HSP90B1 Sigma-Aldrich Cat# HPA008424; RRID: AB_1851184 Rabbit anti-APMAP Sigma-Aldrich Cat# HPA012863; RRID: AB_1845683 Mouse anti-APMAP Novus Biologicals Cat# NBP2-01716 Rabbit anti-EGFP Abcam Cat# ab290; RRID:AB_2313768 Rabbit anti-mCherry Dr. Jonathan Friedman (UT Southwestern Medical Center); Abcam Cat# PA5-34974; RRID: AB_2552323 Mouse anti-CLIMP63 Enzo lifesciences Cat# G1/296; RRID: AB_2051140 Rabbit anti-calnexin Abcam Cat# ab22595; RRID: AB_2069006 Goat anti-Apolipoprotein B Rockland immunochemicals Cat# 600-101-111; RRID: AB_2056958 Rabbit anti-Apolipoprotein B Abcam Cat# ab20737; RRID: AB_2056954 Rabbit anti-ApoII Akhila Rajan (Hutch) N/A Mouse anti-ceramide Enzo lifesciences Cat# ALX-804-196; RRID: AB_10541503 Mouse anti-IRE1alpha Cell Signalling Cat# 14C10 Mouse anti-ERO1A, Clone 2G4/12 Sigma-Aldrich Cat# MABT376; RRID: AB_2941031 Mouse anti-P4HB Abcam Cat# ab2792; RRID: AB_303304 Mouse anti-beta actin Abcam Cat# ab8224; RRID: AB_449644 Rabbit GAPDH Abcam Cat# ab9485; RRID: AB_307275 Alexa Fluor 488 Donkey anti-mouse IgG Thermo Fisher Cat# A21202; RRID: AB_141607 Alexa Fluor 594 Donkey anti-mouse IgG Thermo Fisher Cat# A21203; RRID: AB_141633 Alexa Fluor 488 Donkey anti-rabbit IgG Thermo Fisher Cat# A21206; RRID: AB_2535792 Alexa Fluor 594 Donkey anti-rabbit IgG Thermo Fisher Cat# A21207; RRID: AB_141637 Alexa Fluor 488 Donkey anti-goat IgG Thermo fisher Cat# A11055; RRID: AB_2534102 Alexa Fluor 594 Donkey anti-goat IgG Thermo fisher Cat# A11058; RRID: AB_2534105 HRP-conjugated anti-goat IgG Thermo Fisher Cat# PA128664; RRID: AB_10990162 Chemicals, Peptides and Recombinant Proteins Oleic acid Sigma Cat# O1008 Tetramethylbenzidine (TMB) Peroxidase Millipore Sigma Cat# T0440 N-Acetyl Cysteine Sigma Cat# A9165 Tert-Butyl Hydroperoxide Thermo Fisher Cat# 180345000 Proteinase-K Sigma Cat# P2308 Digitonin Sigma Cat# 300410 Fumonisin B1 Sigma Cat# F1147 Myriocin Sigma Cat# M1177 Hydrogen peroxide Sigma Cat# H1009 BODIPY 581/591-C11 Thermo Fisher Cat# D3861 Triton X-100 N/A Autodot Abgent Cat# SM1000a Trizol Ambion Life Technologies Cat# 15596026 VLDL human purified protein Millipore Cat# LP1 Lipofectamine RNAiMAX reagent Thermo Scientific Cat# 13778075 Lipofectamine 3000 Invitrogen Cat# L3000015 Halt protease inhibitor cocktail Thermo Cat# 78429 (Continued on next page) ll Article Developmental Cell 60, 1–18.e1–e10, September 22, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays ReadyScript cDNA synthesis mix Sigma Cat# RDRT-100RXN Gibson assembly mix NEB Cat# E2611L Sso advanced universal SYBR green supermix Biorad Cat# 172-5274 Pierce BCA protein assay kit Thermo Scientific Cat# 23225 Deposited data APMAP TurboID proteomics dataset This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Zebrafish datasets This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Uncropped Western blots This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Experimental models: Cell lines, organisms and strains Human U2OS osteosarcoma cells ATCC U2OS U2OS cell with CRISPR-Cas9 APMAP-mNeonGreen Dr. Mike Henne lab (UT Southwestern Medical Center) APMAP-mNG Huh-7 Dr. Denise Marciano lab (UT Southwestern Medical Center) Huh7 Drosophila L3 late feeding larvae and 7-10 day old adults This study Drosophila larvae Dcg-GAL4 FB driver Dr. Jonathan Graff (UT Southwestern Medical Center) Dcg-Gal4 Da-GAL4 global driver Bloomington Stock Center N/A TRiP UAS-RNAi Hmu (dAPMAP) Bloomington Stock Center 41627 TRiP UAS-RNAi Hmu (dAPMAP) Bloomington Stock Center 41915 Cg-Gal4; UAS-Dcr2 FB driver Dr. Steve Jean (Université de Sherbrooke) N/A UAS-Sec61B-TdTomato Bloomington Stock Center 64747 Oligonucleotides Silencer negative control siRNA Thermo Fisher Cat# AM4611 Silencer Select negative control siRNA Thermo Fisher Cat# 4390843 APMAP silencer select siRNA Thermo Fisher Cat# 4392420; siRNA ID: s32757 APMAP forward primer (RT-PCR) This study CATTGCCCGGTTTGGTTCG APMAP reverse primer (RT-PCR) This study CACTTCACGTTTCCAGGGATTTA CHOP forward primer (RT-PCR) van Schadewijk et al.60 GCACCTCCCAGAGCCCTCACTCTCC CHOP reverse primer (RT-PCR) van Schadewijk et al.60 GTCTACTCCAAGCCTTCCCCCTGCG Xbp1 forward primer (RT-PCR) van Schadewijk et al.60 TGCTGAGTCCGCAGCAGGTG Xbp1 reverse primer (RT-PCR) van Schadewijk et al.60 GCTGGCAGGCTCTGGGGAAG SCD1 primer pairs (RT-PCR) KiCqStart Primers (Sigma Aldrich) H_SCD_1 (NM_005063) PRDX4 primer pairs (RT-PCR) KiCqStart Primers (Sigma Aldrich) H_PRDX4_1 (NM_006406) Cyclophillin Amplicon TATCTGCACTGCCAAGACTGAGTG Cyclophillin Amplicon CTTCTTGCTGGTCTTGCCATTCC Recombinant DNA APMAPFL-EGFP This study N/A Untagged APMAPFL This study N/A APMAPTM(1-77)-EGFP This study N/A APMAPAD(77-416)-EGFP This study N/A APMAPAD-KDEL This study N/A (Continued on next page) ll Article e2 Developmental Cell 60, 1–18.e1–e10, September 22, 2025 .. Experimental models include human Huh7 hepatocarcinoma cells (ATCC), AML12 murine hepatocytes (provided by Dr. Joan FontBurgada lab, FCCC), human U2OS (osteosarcoma cells) (ATCC), and zebrafish larvae (provided by Dr. Steven Farber lab, Johns Hopkins).

    Recombinant:

    Article Title: Paraoxonase-like APMAP maintains endoplasmic-reticulum-associated lipid and lipoprotein homeostasis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-HSP90B1 Sigma-Aldrich Cat# AMAB91019; RRID: AB_2665765 Rabbit anti-HSP90B1 Sigma-Aldrich Cat# HPA008424; RRID: AB_1851184 Rabbit anti-APMAP Sigma-Aldrich Cat# HPA012863; RRID: AB_1845683 Mouse anti-APMAP Novus Biologicals Cat# NBP2-01716 Rabbit anti-EGFP Abcam Cat# ab290; RRID:AB_2313768 Rabbit anti-mCherry Dr. Jonathan Friedman (UT Southwestern Medical Center); Abcam Cat# PA5-34974; RRID: AB_2552323 Mouse anti-CLIMP63 Enzo lifesciences Cat# G1/296; RRID: AB_2051140 Rabbit anti-calnexin Abcam Cat# ab22595; RRID: AB_2069006 Goat anti-Apolipoprotein B Rockland immunochemicals Cat# 600-101-111; RRID: AB_2056958 Rabbit anti-Apolipoprotein B Abcam Cat# ab20737; RRID: AB_2056954 Rabbit anti-ApoII Akhila Rajan (Hutch) N/A Mouse anti-ceramide Enzo lifesciences Cat# ALX-804-196; RRID: AB_10541503 Mouse anti-IRE1alpha Cell Signalling Cat# 14C10 Mouse anti-ERO1A, Clone 2G4/12 Sigma-Aldrich Cat# MABT376; RRID: AB_2941031 Mouse anti-P4HB Abcam Cat# ab2792; RRID: AB_303304 Mouse anti-beta actin Abcam Cat# ab8224; RRID: AB_449644 Rabbit GAPDH Abcam Cat# ab9485; RRID: AB_307275 Alexa Fluor 488 Donkey anti-mouse IgG Thermo Fisher Cat# A21202; RRID: AB_141607 Alexa Fluor 594 Donkey anti-mouse IgG Thermo Fisher Cat# A21203; RRID: AB_141633 Alexa Fluor 488 Donkey anti-rabbit IgG Thermo Fisher Cat# A21206; RRID: AB_2535792 Alexa Fluor 594 Donkey anti-rabbit IgG Thermo Fisher Cat# A21207; RRID: AB_141637 Alexa Fluor 488 Donkey anti-goat IgG Thermo fisher Cat# A11055; RRID: AB_2534102 Alexa Fluor 594 Donkey anti-goat IgG Thermo fisher Cat# A11058; RRID: AB_2534105 HRP-conjugated anti-goat IgG Thermo Fisher Cat# PA128664; RRID: AB_10990162 Chemicals, Peptides and Recombinant Proteins Oleic acid Sigma Cat# O1008 Tetramethylbenzidine (TMB) Peroxidase Millipore Sigma Cat# T0440 N-Acetyl Cysteine Sigma Cat# A9165 Tert-Butyl Hydroperoxide Thermo Fisher Cat# 180345000 Proteinase-K Sigma Cat# P2308 Digitonin Sigma Cat# 300410 Fumonisin B1 Sigma Cat# F1147 Myriocin Sigma Cat# M1177 Hydrogen peroxide Sigma Cat# H1009 BODIPY 581/591-C11 Thermo Fisher Cat# D3861 Triton X-100 N/A Autodot Abgent Cat# SM1000a Trizol Ambion Life Technologies Cat# 15596026 VLDL human purified protein Millipore Cat# LP1 Lipofectamine RNAiMAX reagent Thermo Scientific Cat# 13778075 Lipofectamine 3000 Invitrogen Cat# L3000015 Halt protease inhibitor cocktail Thermo Cat# 78429 (Continued on next page) ll Article Developmental Cell 60, 1–18.e1–e10, September 22, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays ReadyScript cDNA synthesis mix Sigma Cat# RDRT-100RXN Gibson assembly mix NEB Cat# E2611L Sso advanced universal SYBR green supermix Biorad Cat# 172-5274 Pierce BCA protein assay kit Thermo Scientific Cat# 23225 Deposited data APMAP TurboID proteomics dataset This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Zebrafish datasets This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Uncropped Western blots This study In Mendeley Dataset ‘‘Paul et al. APMAP’’ https://doi.org/10.17632/vzfmz6stnc.1 Experimental models: Cell lines, organisms and strains Human U2OS osteosarcoma cells ATCC U2OS U2OS cell with CRISPR-Cas9 APMAP-mNeonGreen Dr. Mike Henne lab (UT Southwestern Medical Center) APMAP-mNG Huh-7 Dr. Denise Marciano lab (UT Southwestern Medical Center) Huh7 Drosophila L3 late feeding larvae and 7-10 day old adults This study Drosophila larvae Dcg-GAL4 FB driver Dr. Jonathan Graff (UT Southwestern Medical Center) Dcg-Gal4 Da-GAL4 global driver Bloomington Stock Center N/A TRiP UAS-RNAi Hmu (dAPMAP) Bloomington Stock Center 41627 TRiP UAS-RNAi Hmu (dAPMAP) Bloomington Stock Center 41915 Cg-Gal4; UAS-Dcr2 FB driver Dr. Steve Jean (Université de Sherbrooke) N/A UAS-Sec61B-TdTomato Bloomington Stock Center 64747 Oligonucleotides Silencer negative control siRNA Thermo Fisher Cat# AM4611 Silencer Select negative control siRNA Thermo Fisher Cat# 4390843 APMAP silencer select siRNA Thermo Fisher Cat# 4392420; siRNA ID: s32757 APMAP forward primer (RT-PCR) This study CATTGCCCGGTTTGGTTCG APMAP reverse primer (RT-PCR) This study CACTTCACGTTTCCAGGGATTTA CHOP forward primer (RT-PCR) van Schadewijk et al.60 GCACCTCCCAGAGCCCTCACTCTCC CHOP reverse primer (RT-PCR) van Schadewijk et al.60 GTCTACTCCAAGCCTTCCCCCTGCG Xbp1 forward primer (RT-PCR) van Schadewijk et al.60 TGCTGAGTCCGCAGCAGGTG Xbp1 reverse primer (RT-PCR) van Schadewijk et al.60 GCTGGCAGGCTCTGGGGAAG SCD1 primer pairs (RT-PCR) KiCqStart Primers (Sigma Aldrich) H_SCD_1 (NM_005063) PRDX4 primer pairs (RT-PCR) KiCqStart Primers (Sigma Aldrich) H_PRDX4_1 (NM_006406) Cyclophillin Amplicon TATCTGCACTGCCAAGACTGAGTG Cyclophillin Amplicon CTTCTTGCTGGTCTTGCCATTCC Recombinant DNA APMAPFL-EGFP This study N/A Untagged APMAPFL This study N/A APMAPTM(1-77)-EGFP This study N/A APMAPAD(77-416)-EGFP This study N/A APMAPAD-KDEL This study N/A (Continued on next page) ll Article e2 Developmental Cell 60, 1–18.e1–e10, September 22, 2025 .. Experimental models include human Huh7 hepatocarcinoma cells (ATCC), AML12 murine hepatocytes (provided by Dr. Joan FontBurgada lab, FCCC), human U2OS (osteosarcoma cells) (ATCC), and zebrafish larvae (provided by Dr. Steven Farber lab, Johns Hopkins).



    Similar Products

    apmap silencer select sirna  (Thermo Fisher)
    90
    Thermo Fisher apmap silencer select sirna
    Apmap Silencer Select Sirna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/apmap+silencer+select+sirna/apmap+silencer+select+sirna/pm40318637-325-199-203
    Average 90 stars, based on 1 article reviews
    apmap silencer select sirna - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results